Miércoles, 2019-01-16
My site
Site menu

Total en línea: 1
Invitados: 1
Usuarios: 0
Login form

Neandertal mtDNA (Query) compared with Human mtDNA (Sbjct):


24 differences including an INSERTION altering the reading frame (comparing a

fragment of 378 nucleotides)


Krings,M., Stone,A., Schmitz,R.W., Krainitzki,H., Stoneking,M. and Paabo,S., 
Neandertal DNA sequences and the origin of modern humans, 
Cell 90 (1), 19-30 (1997)
Homo sapiens neanderthalensis mitochondrial D-loop hypervariable region 1
>gi|13272864|gb|AF346985.1|AF346985 Homo sapiens mitochondrion, complete genome.
Length = 16567
 Score = 509 bits (257), Expect = e-142
 Identities = 346/378 (91%), Gaps = 1/378 (0%)
 Strand = Plus / Plus
Query: 1 gttctttcatgggggagcagatttgggtaccacccaagtattgactcacccatcagcaac 60
 |||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 16021 gttctttcatggggaagcagatttgggtaccacccaagtattgactcacccatcaacaac 16080
Query: 61 cgctatgtatctcgtacattactgttagttaccatgaatattgtacagtaccataattac 120
 |||||||||| ||||||||||||| || |||||||||||||||||||||||||| |||
Sbjct: 16081 cgctatgtatttcgtacattactgccagccaccatgaatattgtacagtaccataaatac 16140
Query: 121 ttgactacctgcagtacataaaaacctaatccacatcaaacccccccccccatgcttaca 180
 ||||||||||| ||||||||||||| || |||||||||| ||| ||||||||||||||
Sbjct: 16141 ttgactacctgtagtacataaaaactcaacccacatcaaaaccctgcccccatgcttaca 16200
Query: 181 agcaagcacagcaatcaaccttcaactgtcatacatcaactacaactccaaagacgccct 240
 |||||| |||||||||||||||||||||||| ||||||||| ||||||||||| | ||| 
Sbjct: 16201 agcaagtacagcaatcaaccttcaactgtcacacatcaactgcaactccaaagccacccc 16260
Query: 241 tacacccactaggatatcaacaaacctacccacccttgacagtacatagcacataaagtc 300
 | |||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 16261 t-cacccactaggataccaacaaacctacccacccttaacagtacatagcacataaagtc 16319
Query: 301 atttaccgtacatagcacattacagtcaaatcccttctcgcccccatggatgacccccct 360
Sbjct: 16320 atttaccgtacatagcacattacagtcaaatcccttctcgcccccatggatgacccccct 16379
Query: 361 cagataggggtcccttga 378
Sbjct: 16380 cagataggggtcccttga 16397



11 differences including 3 INSERTIONS (comparing a fragment of 345 nucleotides)


Krings,M., Geisert,H., Schmitz,R.W., Krainitzki,H. and Paabo,S., 
DNA sequence of the mitochondrial hypervariable region II from the neandertal type specimen, 
Proc. Natl. Acad. Sci. U.S.A. 96 (10), 5581-5585 (1999).

Homo sapiens neanderthalensis mitochondrial control region, hypervariable region II.

Homo sapiens mitochondrial SDS-stable vimentin-bound DNA fragment 
HEF42VIM24. Length = 743
 Score = 593 bits (299), Expect = e-167
 Identities = 334/345 (96%), Gaps = 3/345 (0%)
 Strand = Plus / Plus
Query: 1 ttttcgtctggggggtgtgcacgcgatagcattgcgagacgctggagccggagcacccta 60
Sbjct: 57 ttttcgtctggggggtgtgcacgcgatagcattgcgagacgctggagccggagcacccta 116
Query: 61 tgtcgcagtatctgtctttgattcctgccccattccattatttatcgcacctacgttcaa 120
 ||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||
Sbjct: 117 tgtcgcagtatctgtctttgattcctgcctcatcccattatttatcgcacctacgttcaa 176
Query: 121 tattacaggcgagcatacttactaaagtgtgttaattaattaatgcttgtaggacataat 180
  |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 177 tattacaggcgaacatacttactaaagtgtgttaattaattaatgcttgtaggacataat 236
Query: 181 aataacgactaaatgtctgcacagctgctttccacacagacatcataacaaaaaatttcc 240
 |||||| | | |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 237 aataacaattgaatgtctgcacagccgctttccacacagacatcataacaaaaaatttcc 296
Query: 241 accaaaccccctttcctcccccgcttctggccacagcacttaaacacatctctgccaaac 300
 ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 297 accaaaccccc---cctcccccgcttctggccacagcacttaaacacatctctgccaaac 353
Query: 301 cccaaaaacaaagaaccctaacaccagcctaaccagacttcaaat 345
 ||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 354 cccaaaaacaaagaaccctaacaccagcctaaccagatttcaaat 398



19 differences including one INSERTION altering the reading frame (comparing a fragment of 345 nucleotides)

Ovchinnikov,I.V., Gotherstrom,A., Romanova,G.P., Kharitonov,V.M., Liden,K. and Goodwin,W., 
Molecular analysis of Neanderthal DNA from the northern Caucasus, 
Nature 404 (6777), 490-493 (2000).

Homo sapiens neanderthalensis mitochondrial D-loop, hypervariable region I.

>gi|13272864|gb|AF346985.1|AF346985 Homo sapiens mitochondrion, 
complete genome. Length = 16567
 Score = 486 bits (245), Expect = e-135
 Identities = 318/345 (92%), Gaps = 1/345 (0%)
 Strand = Plus / Plus
Query: 1 ccaagtattgactcacccatcaacaaccgccatgtatttcgtacattactgccagccacc 60
 |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 16054 ccaagtattgactcacccatcaacaaccgctatgtatttcgtacattactgccagccacc 16113
Query: 61 atgaatattgtacagtaccataattacttgactacctgtaatacataaaaacctaatcca 120
 ||||||||||||||||||||||| |||||||||||||||| ||||||||||| || |||
Sbjct: 16114 atgaatattgtacagtaccataaatacttgactacctgtagtacataaaaactcaaccca 16173
Query: 121 catcaaccccccccccccatgcttacaagcaagcacagcaatcaaccttcaactgtcata 180
 |||||| ||| |||||||||||||||||||| |||||||||||||||||||||||| |
Sbjct: 16174 catcaaaaccctgcccccatgcttacaagcaagtacagcaatcaaccttcaactgtcaca 16233
Query: 181 catcaactacaactccaaagacacccttacacccactaggatatcaacaaacctacccac 240
 |||||||| ||||||||||| ||||| | |||||||||||||| ||||||||||||||||
Sbjct: 16234 catcaactgcaactccaaagccacccct-cacccactaggataccaacaaacctacccac 16292
Query: 241 ccttgacagtacatagcacataaagtcatttaccgtacatagcacattatagtcaaatcc 300
 |||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 16293 ccttaacagtacatagcacataaagtcatttaccgtacatagcacattacagtcaaatcc 16352
Query: 301 cttctcgcccccatggatgacccccctcagataggggtcccttga 345
Sbjct: 16353 cttctcgcccccatggatgacccccctcagataggggtcccttga 16397



19 differences including one INSERTION altering the reading frame (comparing a fragment of 357 nucleotides)

Krings,M., Capelli,C., Tschentscher,F., Geisert,H., Meyer,S., von Haeseler,A., Grossschmidt,K., Possnert,G., 
Paunovic,M. and Paabo,S., A view of neandertal genetic diversity, Nat. Genet. 
26 (2), 144-146 (2000).

Homo sapiens neanderthalensis mitochondrial hypervariable region I sequence.

>gi|13272864|gb|AF346985.1|AF346985 Homo sapiens mitochondrion, 
complete genome. Length = 16567
 Score = 502 bits (253), Expect = e-140
 Identities = 329/357 (92%), Gaps = 1/357 (0%)
 Strand = Plus / Plus
Query: 1 gttctttcatgggggagcagatttgggtaccacccaagtattgactcacccatcagcaac 60
 |||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 16021 gttctttcatggggaagcagatttgggtaccacccaagtattgactcacccatcaacaac 16080
Query: 61 cgctatgtatttcgtacattactgccagccaccatgaatattgtacagtaccataattac 120
 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 16081 cgctatgtatttcgtacattactgccagccaccatgaatattgtacagtaccataaatac 16140
Query: 121 ttgactacctgcagtacataaaaacctaatccacatcaaccccccccccccatgcttaca 180
 ||||||||||| ||||||||||||| || ||||||||| ||| ||||||||||||||
Sbjct: 16141 ttgactacctgtagtacataaaaactcaacccacatcaaaaccctgcccccatgcttaca 16200
Query: 181 agcaagcacagcaatcaaccttcaactgtcatacatcaactacaactccaaagacgccct 240
 |||||| |||||||||||||||||||||||| ||||||||| ||||||||||| | ||| 
Sbjct: 16201 agcaagtacagcaatcaaccttcaactgtcacacatcaactgcaactccaaagccacccc 16260
Query: 241 tacacccactaggatatcaacaaacctacccacccttgacagtacatagcacataaagtc 300
 | |||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 16261 t-cacccactaggataccaacaaacctacccacccttaacagtacatagcacataaagtc 16319
Query: 301 atttaccgtacatagcacattacagtcaaatcccttctcgcccccatggatgacccc 357
Sbjct: 16320 atttaccgtacatagcacattacagtcaaatcccttctcgcccccatggatgacccc 16376

9 differences including a DELETION altering the reading frame (comparing a fragment of 288 nucleotides)
Krings,M., Capelli,C., Tschentscher,F., Geisert,H., Meyer,S., von Haeseler,A., Grossschmidt,K., Possnert,G., 
Paunovic,M. and Paabo,S., A view of neandertal genetic diversity, Nat. Genet. 26 (2), 144-146 (2000).

Homo sapiens neanderthalensis mitochondrial hypervariable region II sequence.

>gi|13272794|gb|AF346980.1|AF346980 Homo sapiens mitochondrion, 
complete genome. Length = 16570
 Score = 494 bits (249), Expect = e-137
 Identities = 280/289 (96%), Gaps = 1/289 (0%)
 Strand = Plus / Plus
Query: 1 ttttcgtctggggggtgtgcacgcgatagcattgcgagacgctggagccggagcacccta 60
Sbjct: 57 ttttcgtctggggggtgtgcacgcgatagcattgcgagacgctggagccggagcacccta 116
Query: 61 tgtcgcagtatctgtctttgattcctgccccattccattatttatcgcacctacgttcaa 120
 ||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||
Sbjct: 117 tgtcgcagtatctgtctttgattcctgcctcattctattatttatcgcacctacgttcaa 176
Query: 121 tattacaggcgagcatacttactgaagtgtgttaattaattaatgcttgtaggacataat 180
Sbjct: 177 tattacaggcgagcatacttactgaagtgtgttaattaattaatgcttgtaggacataat 236
Query: 181 aataacgactaaatgtctgcacagctgctttccacacagacatcataacaaaaaatttcc 240
 |||||| | | |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 237 aataacaattgaatgtctgcacagccgctttccacacagacatcataacaaaaaatttcc 296
Query: 241 accaaacctccccct-cccccgcttctggccacagcacttaaatacatc 288
 |||||||| |||||| ||||||||||||||||||||||||||| |||||
Sbjct: 297 accaaacccccccctccccccgcttctggccacagcacttaaacacatc 345
18 Differences including one INSERTION altering the reading frame (comparing a 
fragment of 357 nucleotides)
Schmitz,R.W., Serre,D., Bonani,G., Feine,S., Hillgruber,F., Krainitzki,H., 
Paabo,S. and Smith,F.H., The Neandertal type site revisited: 
interdisciplinary investigations of skeletal remains from the Neander 
Valley, Germany, Proc. Natl. Acad. Sci. U.S.A. 99 (20), 13342-13347 (2002).
>gi|13272864|gb|AF346985.1|AF346985 Homo sapiens mitochondrion, 
complete genome. Length = 16567
 Score = 509 bits (257), Expect = e-142
 Identities = 330/357 (92%), Gaps = 1/357 (0%)
 Strand = Plus / Plus
Query: 1 gttctttcatgggggagcagatttgggtaccacccaagtattgactcacccatcagcaac 60
 |||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 16021 gttctttcatggggaagcagatttgggtaccacccaagtattgactcacccatcaacaac 16080
Query: 61 cgctatgtatttcgtacattactgccagccaccatgaatattgtacagtaccataattac 120
 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 16081 cgctatgtatttcgtacattactgccagccaccatgaatattgtacagtaccataaatac 16140
Query: 121 ttgactacctgcagtacataaaaacctaatccacatcaaccccccccccccatgcttaca 180
 ||||||||||| ||||||||||||| || ||||||||| ||| ||||||||||||||
Sbjct: 16141 ttgactacctgtagtacataaaaactcaacccacatcaaaaccctgcccccatgcttaca 16200
Query: 181 agcaagcacagcaatcaaccttcaactgtcatacatcaactacaactccaaagacaccct 240
 |||||| |||||||||||||||||||||||| ||||||||| ||||||||||| ||||| 
Sbjct: 16201 agcaagtacagcaatcaaccttcaactgtcacacatcaactgcaactccaaagccacccc 16260
Query: 241 tacacccactaggatatcaacaaacctacccacccttgacagtacatagcacataaagtc 300
 | |||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 16261 t-cacccactaggataccaacaaacctacccacccttaacagtacatagcacataaagtc 16319
Query: 301 atttaccgtacatagcacattacagtcaaatcccttctcgcccccatggatgacccc 357
Sbjct: 16320 atttaccgtacatagcacattacagtcaaatcccttctcgcccccatggatgacccc 16376


A pertinent link with one of the late Neanderthal hybrids in chain-armor found by Kazimierz Stolyhwo in Nowosiolka, Poland, and its 1908 report in Globus, Nature, etc.: http://fdocc.ucoz.com/2/stolyhwo_chain-armor_hybrid_neanderthal.pdf 

Site friends
  • Create your own site
  • Copyright MyCorp © 2019
    Alojamiento web gratis - uCoz